Posts by admin

In the office…

Posted in tumblelog

This has been reposted from our lab tumblelog July 07, 2015 at 11:48AM via iOS Location http://ift.tt/1DenCkQ via the Lab Tumblr: http://ift.tt/1dKqEHP

Read More

In the office…

Posted in tumblelog

This has been reposted from our lab tumblelog July 07, 2015 at 08:52AM via iOS Location http://ift.tt/1DenCkQ via the Lab Tumblr: http://ift.tt/1CYtfEI

Read More

Open Research and Your Career: an OpenCon Webcast Series | OpenCon 2015

Posted in Bookmarks

Visit http://ift.tt/1KLqDR4 to see original document. Or explore all of Steven’s bookmarks on Pinboard.

Read More

7 6 2015 Actin qPCR rerun

Posted in Lab Notebook

After noting some significant discrepancies between replicates last week we decided to change the protocol to better help optimize the process and make the data more consistent between runs. Today I’m running two replicates of Actin but this post will only cover the first one. Primers: 1505 Ol_Act_F GACCAGCCAAATCCAGACGA BC 6/13/2012 20 55 60 O.lurida Actin, adductor muscle 1504 Ol_Act_R CGGTCGTACCACTGGTATCG 6/13/2012 20 60 60 O.lurida Actin, adductor muscle  To help with optimization I made a 1:9 dilution of cDNA so that pipette error would not affect the...

Read More

In the office…

Posted in tumblelog

This has been reposted from our lab tumblelog July 06, 2015 at 12:57PM via iOS Location http://ift.tt/1DenCkQ via the Lab Tumblr: http://ift.tt/1H4MYV3

Read More