Posts by admin

5 28 2015 New Primer Check (13-23)

Posted in Lab Notebook

Today I completed the primer checks for the new primers. This run is less promising than yesterdays as it doesn’t have any primers that show any real difference in them. There were more than a couple that failed in some manner. To make the working stock of the primers. 90 ul of Nuclease free (or Nanopure) H20 to 1.5 ml tube 10 ul of Stock primers Vortex briefly I made these carefully in order to produce the following 12 pairs of primers.  1626 HSP70c_FWD AGGAAAGGTCGGGAGAGGAA JH 5/21/2015 20 55 O.lurida Heat shock 70 kDa protein...

Read More

Bioanalyzer – Geoduck Gonad RNA Quality Assessment

Posted in Lab Notebook

Before proceeding with transcriptomics for this project, we need to assess the integrity of the RNA via Bioanalyzer. RNA that was previously isolated on 20150508, 20150505, 20150427, and 20150424 (those notebook entries have been updated to report this consolidation and have a link to this notebook entry) were consolidated into single samples (if there had been multiple isolations of the same sample) and spec’d on the Roberts Lab NanoDrop1000: Google Sheet: 20150528_geoduck_histo_RNA_ODs NOTE: Screwed up consolidation of Geoduck Block 03 sample (added one of the 04 dupes to the tube,...

Read More

5 27 2015 New Primer Check (1-12)

Posted in Lab Notebook

Yesterday I received the new primers that I designed using the oly transcriptome. You can read about that here. Sam rehydrated the original stocks and I produced work stocks from them to use in a plate. To make the working stock of the primers. 90 ul of Nuclease free (or Nanopure) H20 to 1.5 ml tube 10 ul of Stock primers Vortex briefly I made these carefully in order to produce the following 12 pairs of primers.  Hspb11_FWD ATGTTTCCTGGTCTCCGTCA JH 5/21/2015 20 55 O.lurida Heat shock protein beta-11 (Hspb11) (Placental protein 25)...

Read More

RT @lakens: The badges in Psych Science have increased data sharing from 0% to 25% in a single year, says @BrianNosek

Posted in tumblelog

This has been reposted from our lab tumblelog The badges in Psych Science have increased data sharing from 0% to 25% in a single year, says @BrianNosek — Daniël Lakens (@lakens) May 27, 2015 from Twitter https://twitter.com/sr320 May 28, 2015 at 12:34PM via IFTTT via the Lab Tumblr:...

Read More

5 27 2015 Actin HSP70 re run

Posted in Lab Notebook

After reviewing yesterdays qPCR run with Steven, it was decided that I should re run the Actin and HSP70 qPCR again but with a higher annealing temperature. I’ve been using 55 C for previous runs but was having some issues with products and melt curves. Master Mix Reagent Table. Volume Reactions X18 Ssofast Evagreen MM 10 180 FWD Primer 0.5 9 REV Primer 0.5 9 Nuclease Free H2O 8 144 cDNA 1 1. Added each from greatest volume to least to make the master mix for each primer.  2. Pipetted 19 ul master mix into each well of a qPCR partial plate 3. Added 1 ul...

Read More