Sifting Sands

Below is a quick workflow I am using to help Drinan annotate ~1.5 million sequences from an amplicon targeting NGS effort of sand. head /Users/sr320/Dropbox/hummingbird-ipython-nbs/data/DanD/meiofauna_forward_sequences.fa >M02215:33:000000000-AFA9E:1:1101:14961:2005 1:N:0:15 TGACTGTGCTAAGGTAGCATAATTAATTGTCTTTTAATTAGAGACTTGTTTGAAAGATTT TTTGAATTTAATATAGTTTTAAAATTATAAAAATGAATTTTTATATATTGGTAAAAATAC CATGATTTTTTAAAAAGACGATAAGACCCTATCAAGTTTTACTTAAATTTAAAGAAAATT TAGGTTTTAATGGGGCATTATTATTTATTTTAAATAAATTTTGATCTTAAATTAAATTTT AGGAAATTTAATAAAATTACTGTAGGGATAACAGTGTAATATTTTTTAAAGTTCATATTT A >M02215:33:000000000-AFA9E:1:1101:11050:2011 1:N:0:15 TAACTGTGCTAAGGTAGCATAATCACTTGTCTCCTAATTAGAGACTGGCATGAAAGGGTA AACTCTTTATAACTTTATAAAGCATACACACTGAAATTTTTATTTAGACGAAGAAATCTA