In an effort to find a better normalizing gene than actin I searched our primer database for an elongation factor for olys. I found one and have run a pair of qPCR on them. This is the second of the runs.You can see the first here.

Primers:

1509 Ol_Ef1a_F TCCTTGTTCAAACCCTTCATGT BC 6/13/2012 22 40.9 58.1 O.lurida Elongation factor 1-alpha
1508 Ol_Ef1a_R CAAACCCTTGCCTCGGTAAG BC 6/13/2012 20 55 58.8 O.lurida Elongation factor 1-alpha 


Reagent Table:
Volume Reactions X116
Ssofast Evagreen MM 10 1160
FWD Primer 0.5 58
REV Primer 0.5 58
1:9 cDNA 9
  1. Added reagents from greatest to least volume
  2. Vortexed
  3. Centrifuged briefly
  4. Pipetted 11 ul Master Mix to each tube
  5. Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
  6. Centrifuged plate at 2000 rpm for 1 minute
  7. Ran Program Below
Program:
Step Temperature Time
Initiation 95 C 10 min
Elongation 95 C 30 sec
60 C 1 min
Read
72 C 30 sec
Read
Repeat Elongation 39 times
Termination 95 C 1 min
55 C 1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C 55 – 95 C 30 sec
21 C 10 min
End
Plate Layout:
1 2 3 4 5 6 7
DNased 42215 HC1 DNased 42215 NC1 DNased 42215 SC1 DNased 42215 HT1 1 DNased 42215 NT1 1 DNased 42215 ST1 1 NTC
DNased 42215 HC2 DNased 42215 NC2 DNased 42215 SC2 DNased 42215 HT1 2 DNased 42215 NT1 2 DNased 42215 ST1 2 NTC
DNased 42215 HC3 DNased 42215 NC3 DNased 42215 SC3 DNased 42215 HT1 3 DNased 42215 NT1 3 DNased 42215 ST1 3 NTC
DNased 42215 HC4 DNased 42215 NC4 DNased 42215 SC4 DNased 42215 HT1 4 DNased 42215 NT1 4 DNased 42215 ST1 4 NTC
DNased 42215 HC5 DNased 42215 NC5 DNased 42215 SC5 DNased 42215 HT1 5 DNased 42215 NT1 5 DNased 42215 ST1 5
DNased 42215 HC6 DNased 42215 NC6 DNased 42215 SC6 DNased 42215 HT1 6 DNased 42215 NT1 6 DNased 42215 ST1 6
DNased 42215 HC7 DNased 42215 NC7 DNased 42215 SC7 DNased 42215 HT1 7 DNased 42215 NT1 7 DNased 42215 ST1 7
DNased 42215 HC8 DNased 42215 NC8 DNased 42215 SC8 DNased 42215 HT1 8 DNased 42215 NT1 8 DNased 42215 ST1 8
Results:

All samples
NTCs


This like yesterday run also have very little amplification. Only one sample showed amplification of the target. Overall this is not a good gene for normalization. Today I’m going to run through my histone targets to see if they work as normalization genes. 

from Jake Heare Research Central http://ift.tt/1Hy0tge

7 14 2015 Elongation qPCR run 2